HR Excellence in Science
Date: 30.12.2019

Wishes to New Year in genetic code

We have already wished you in Czech and English language, however, we would like to add few words now also in genetic code as it is the field of our research, too.

 

In the upcoming year 2020, we wish to all of you:

GGTTAGTAGGATCATGAAGCTTTAACTCATCATGCTCCTCCTATTAATGAATCTTCTGCTAATGATTCTTGATGTTGTGAATCTTCTATTAATTGGTAGCGTAAAGCTTCTTGGGAATTATTAGCTTCTATTAATTATTAGTGACGTCCTGAACGTTCTTAGAATGCTTTATTAATTTTTGAA

Text of the wish uses alternative translation of STOP-codon "TAG" and can be simply copied and translated by our web program DNA encoder. You can use this program not only to create similar text in genetic code, but also to teach or to demonstrate how genetic code works.

Back

 

CONTACT

Biology Centre CAS
Branišovská 1160/31
370 05 České Budějovice

 

+420 387 775 111 (switchboard)
+420 387 775 051 (secretariat)
+420 778 468 552 (for media)
Data box: r84nds8

NEWS FROM WEB

Biologické centrum Google mapa

Login to the intranet

To log into the intranet enter your login details

×