HR Excellence in Science
Datum: 30.12.2019

Přání do nového roku v DNA kódu

V češtině i angličtině jsme už přáli, ale vzhledem k oboru našeho výzkumu si před koncem roku dovolíme popřát ještě v genetickém kódu.

 

Do nadcházejícího roku 2020 vám všem přejeme:

CATTAGGATAATGAATCTACTGAATCTACTATTATGGCTTTATAGAATGAAATGTAGTGTATTGCTCCTCGTATTATGGAACGTGAAAATGAATGATCTCCTGAATGTCATTGAGTTCCTCGTGCTTGTATTATTATGATTATGTAGAATATT

 

Přání využívá alternativní překlad STOP-kodónu "TAG" a do lidského jazyka jej lze přeložit pomocí našeho webového programu DNA-šifrovač (stačí nakopírovat). Můžete jej využít nejen na tvorbu vlastních přání v genetickém kódu, ale třeba i při výuce nebo demonstraci toho, jak vlastně genetický kód funguje.

 

Zpět

 

KONTAKT

Biologické centrum AV ČR, v.v.i.
Branišovská 1160/31
370 05 České Budějovice

 

+420 387 775 111 (ústředna)
+420 387 775 051 (sekretariát)
+420 778 468 552 (pro média)
Datová schránka: r84nds8

NOVINKY Z WEBU

Biologické centrum Google mapa

Přihlášení do intranetu

Pro přihlášení do intranetu zadejte Vaše přihlašovací údaje

×